complementary dna library (Thermo Fisher)

Thermo Fisher is a verified supplier

Thermo Fisher manufactures this product

About

News

Press Release

Team

Advisors

Partners

Contact

Bioz Stars

Bioz vStars

Buy from Supplier

Structured Review

Thermo Fisher complementary dna library
Complementary Dna Library, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/complementary+dna+libraries/Deoxyribonucleic+acid/pmc12694611-93-32-40
Average 99 stars, based on 1 article reviews

complementary dna library - by Bioz Stars, 2026-11

99/100 stars

Images

other:

Article Title: Repurposing propranolol as an antitumor agent in von Hippel-Lindau disease
Article Snippet: An ELx800 96-well spectrometer (BioTek Instruments) was used to perform all absorbance measurements.

Reverse Transcription:

Article Title: Sex Differences in Ketogenic Diet Response Reveal Gonadal Hormone Interaction With FGF21 in Mice
Article Snippet: RNA concentration was quantified with the Nanodrop spectrophotometer. .. Complementary DNA libraries were prepared from total RNA using the Applied Biosystems High-Capacity Reverse Transcription kit (Applied Biosystems 4368814). ..

Article Title: Control of nitrogen fixation in bacteria that associate with cereals
Article Snippet: The 3′ ends of the RNA fragments were dephosphorylated using 20 U T4 polynucleotide kinase (New England Biolabs) in a 20-μl reaction volume supplemented with 20 U SUPERase·In (Invitrogen) at 37 °C for 1 h, after which the denatured fragments (5 pmol) were incubated at 80 °C for 2 min and ligated to 1 μg of the oligo (/5rApp/CTGTAGGCACCATCAAT/3ddc/; Integrated DNA Technologies) in a 20-μl reaction volume supplemented with 8 μl of 50% PEG 8000, 2 μl 10×T4 RNA ligase 2 buffer, 1 μl of 200 U μl−1 truncated K277Q T4 ligase 2 (New England Biolabs, cat. no. M0351) and 1 μl of 20 U μl−1 SUPERase·In at 25 °C for 3 h. The ligated fragments (35–65 bp) were isolated from a 10% TBE–urea polyacrylamide gel (Thermo Fisher Scientific, cat. no. EC6875). .. Complementary DNA libraries from the purified mRNA products were reverse-transcribed using Superscript III (Invitrogen, cat. no. 18080044) with the oCJ485 primer (/5Phos/AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT/ iSp18/CAAGCAGAAGACGGCATACGAGATATTGATGGTGCCTACAG) at 50 °C for 30 min and the RNA products were subsequently hydrolysed by the addition of NaOH to a final concentration of 0.1 M, followed by incubation at 95 °C for 15 min. .. The cDNA libraries (125–150 bp) were isolated from a 10% TBE–urea polyacrylamide gel (Thermo Fisher Scientific, cat. no. EC6875).

Article Title: Control of nitrogen fixation in bacteria that associate with cereals
Article Snippet: The 3′ ends of the RNA fragments were dephosphorylated using 20 U T4 polynucleotide kinase (New England Biolabs) in a 20-μl reaction volume supplemented with 20 U SUPERase·In (Invitrogen) at 37 °C for 1 h, after which the denatured fragments (5 pmol) were incubated at 80 °C for 2 min and ligated to 1 μg of the oligo (/5rApp/CTGTAGGCACCATCAAT/3ddc/; Integrated DNA Technologies) in a 20-μl reaction volume supplemented with 8 μl of 50% PEG 8000, 2 μl 10×T4 RNA ligase 2 buffer, 1 μl of 200 U μl −1 truncated K277Q T4 ligase 2 (New England Biolabs, cat. no. M0351) and 1 μl of 20 U μl −1 SUPERase·In at 25 °C for 3 h. The ligated fragments (35–65 bp) were isolated from a 10% TBE–urea polyacrylamide gel (Thermo Fisher Scientific, cat. no. EC6875). .. Complementary DNA libraries from the purified mRNA products were reverse-transcribed using Superscript III (Invitrogen, cat. no. 18080044) with the oCJ485 primer (/5Phos/AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT/iSp18/CAAGCAGAAGACGGCATACGAGATATTGATGGTGCCTACAG) at 50 °C for 30 min and the RNA products were subsequently hydrolysed by the addition of NaOH to a final concentration of 0.1 M, followed by incubation at 95 °C for 15 min. .. The cDNA libraries (125–150 bp) were isolated from a 10% TBE–urea polyacrylamide gel (Thermo Fisher Scientific, cat. no. EC6875).

Article Title: Neoantigens expressed in ovarian cancer and their uses
Article Snippet: Next, 3-10 ng of cDNA was pre-amplified for 10 PCR cycles in 15 μl of pre-amplification mix using TaqMan preamplification kit (ThermoFisher Scientific, #4384267). .. Complementary DNA libraries were prepared using oligo dT primers provided in the high-capacity cDNA reverse transcription kit (Invitrogen-part #11904018) from 200 ng of total RNA. .. Next, 3-10 ng of cDNA was pre-amplified for 10 PCR cycles in 15 μl of pre-amplification mix using TaqMan preamplification kit (ThermoFisher Scientific, #4384267).

Article Title: Cognitive Phenotype and Differential Gene Expression in a Hippocampal Homologue in Two Species of Frog.
Article Snippet: .. We created complementary DNA libraries using Invitrogen SuperScript II Reverse Transcriptase kits, performed library preparation using Illumina TruSeq (Illumina, Inc., San Diego, CA) and sequenced the transcriptomes on an Illumina HiSeq 2000 platform with 50 bp paired end reads. ..

Purification:

Article Title: Control of nitrogen fixation in bacteria that associate with cereals
Article Snippet: The 3′ ends of the RNA fragments were dephosphorylated using 20 U T4 polynucleotide kinase (New England Biolabs) in a 20-μl reaction volume supplemented with 20 U SUPERase·In (Invitrogen) at 37 °C for 1 h, after which the denatured fragments (5 pmol) were incubated at 80 °C for 2 min and ligated to 1 μg of the oligo (/5rApp/CTGTAGGCACCATCAAT/3ddc/; Integrated DNA Technologies) in a 20-μl reaction volume supplemented with 8 μl of 50% PEG 8000, 2 μl 10×T4 RNA ligase 2 buffer, 1 μl of 200 U μl −1 truncated K277Q T4 ligase 2 (New England Biolabs, cat. no. M0351) and 1 μl of 20 U μl −1 SUPERase·In at 25 °C for 3 h. The ligated fragments (35–65 bp) were isolated from a 10% TBE–urea polyacrylamide gel (Thermo Fisher Scientific, cat. no. EC6875). .. Complementary DNA libraries from the purified mRNA products were reverse-transcribed using Superscript III (Invitrogen, cat. no. 18080044) with the oCJ485 primer (/5Phos/AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT/iSp18/CAAGCAGAAGACGGCATACGAGATATTGATGGTGCCTACAG) at 50 °C for 30 min and the RNA products were subsequently hydrolysed by the addition of NaOH to a final concentration of 0.1 M, followed by incubation at 95 °C for 15 min. .. The cDNA libraries (125–150 bp) were isolated from a 10% TBE–urea polyacrylamide gel (Thermo Fisher Scientific, cat. no. EC6875).

Concentration Assay:

Article Title: Control of nitrogen fixation in bacteria that associate with cereals
Article Snippet: The 3′ ends of the RNA fragments were dephosphorylated using 20 U T4 polynucleotide kinase (New England Biolabs) in a 20-μl reaction volume supplemented with 20 U SUPERase·In (Invitrogen) at 37 °C for 1 h, after which the denatured fragments (5 pmol) were incubated at 80 °C for 2 min and ligated to 1 μg of the oligo (/5rApp/CTGTAGGCACCATCAAT/3ddc/; Integrated DNA Technologies) in a 20-μl reaction volume supplemented with 8 μl of 50% PEG 8000, 2 μl 10×T4 RNA ligase 2 buffer, 1 μl of 200 U μl −1 truncated K277Q T4 ligase 2 (New England Biolabs, cat. no. M0351) and 1 μl of 20 U μl −1 SUPERase·In at 25 °C for 3 h. The ligated fragments (35–65 bp) were isolated from a 10% TBE–urea polyacrylamide gel (Thermo Fisher Scientific, cat. no. EC6875). .. Complementary DNA libraries from the purified mRNA products were reverse-transcribed using Superscript III (Invitrogen, cat. no. 18080044) with the oCJ485 primer (/5Phos/AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT/iSp18/CAAGCAGAAGACGGCATACGAGATATTGATGGTGCCTACAG) at 50 °C for 30 min and the RNA products were subsequently hydrolysed by the addition of NaOH to a final concentration of 0.1 M, followed by incubation at 95 °C for 15 min. .. The cDNA libraries (125–150 bp) were isolated from a 10% TBE–urea polyacrylamide gel (Thermo Fisher Scientific, cat. no. EC6875).

Incubation:

Article Title: Control of nitrogen fixation in bacteria that associate with cereals
Article Snippet: The 3′ ends of the RNA fragments were dephosphorylated using 20 U T4 polynucleotide kinase (New England Biolabs) in a 20-μl reaction volume supplemented with 20 U SUPERase·In (Invitrogen) at 37 °C for 1 h, after which the denatured fragments (5 pmol) were incubated at 80 °C for 2 min and ligated to 1 μg of the oligo (/5rApp/CTGTAGGCACCATCAAT/3ddc/; Integrated DNA Technologies) in a 20-μl reaction volume supplemented with 8 μl of 50% PEG 8000, 2 μl 10×T4 RNA ligase 2 buffer, 1 μl of 200 U μl −1 truncated K277Q T4 ligase 2 (New England Biolabs, cat. no. M0351) and 1 μl of 20 U μl −1 SUPERase·In at 25 °C for 3 h. The ligated fragments (35–65 bp) were isolated from a 10% TBE–urea polyacrylamide gel (Thermo Fisher Scientific, cat. no. EC6875). .. Complementary DNA libraries from the purified mRNA products were reverse-transcribed using Superscript III (Invitrogen, cat. no. 18080044) with the oCJ485 primer (/5Phos/AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT/iSp18/CAAGCAGAAGACGGCATACGAGATATTGATGGTGCCTACAG) at 50 °C for 30 min and the RNA products were subsequently hydrolysed by the addition of NaOH to a final concentration of 0.1 M, followed by incubation at 95 °C for 15 min. .. The cDNA libraries (125–150 bp) were isolated from a 10% TBE–urea polyacrylamide gel (Thermo Fisher Scientific, cat. no. EC6875).

Review